Golf Kauai Hawaii - Kauai Golf Courses - Kauai Golf Packages

Emergence récente et rapide des souches W-Beijing de Mycobacterium tuberculosis au Cap, Afrique du Sud

Contexte Il existe de plus en plus de preuves d’une variation de la virulence de Mycobacterium tuberculosis liée à la souche qui pourrait conférer un avantage sélectif à certaines souches La souche W-Beijing est mondialement distribuée, fortement virulente dans les modèles animaux associés au virus de l’immunodéficience humaine. Notre objectif était de déterminer si les souches W-Beijing se développent dans une région d’Afrique du Sud où les taux de tuberculose sont parmi les plus élevés au monde. Méthodes Nous avons utilisé le spoligotypage et l’analyse du polymorphisme nucléotidique unique pour génotyper toutes les souches. de la tuberculose chez les enfants se présentant au principal hôpital de référence pédiatrique du Cap, Afrique du Sud, sur une période de plusieurs années et souches présentes dans des échantillons histologiques archivés sur une période de plus d’un anRésultats La proportion de souches W-Pékin à P = En ce qui concerne les échantillons histologiques, les souches W-Beijing étaient absentes nt dans les échantillons de la période – et rare dans les échantillons de la période -% d’échantillons, mais ils étaient de plus en plus fréquents dans les échantillons de la période -% d’échantillons; P = Conclusions L’expansion rapide des souches W-Beijing dans une région à très forte incidence de tuberculose suggère que ces souches ont un avantage sélectif significatif. Les raisons biologiques de cette observation restent floues mais justifient une étude plus approfondie. La propagation rapide de cette souche virulente lignage est susceptible de présenter des défis supplémentaires pour le contrôle de la tuberculose

La famille de souches de Mycobacterium tuberculosis W-Beijing est mondialement distribuée et documentée comme une cause d’éclosion d’infection impliquant souvent des organismes multirésistants Les souches W-Beijing ont été associées à une maladie extrathoracique et à une infection par le VIH Dans les modèles animaux expérimentaux, les souches W-Pékin étaient très virulentes , et les animaux n’étaient pas protégés par un vaccin antérieur contre le bacille Calmette-Guérin Les preuves suggérant que ces souches émergent dans plusieurs régions sont donc préoccupantes . ces preuves sont limitées par de courtes périodes d’observation et des augmentations relativement faibles de la prévalence, qui peuvent ne pas refléter les tendances à long terme. Nous avons montré que la majorité des isolats de M tuberculosis dans la région occidentale du Cap appartiennent à de vastes lignées: W-Beijing et Euro-American Le fardeau de la tuberculose dans cette région est parmi les plus élevés dans le monde. Bien que les taux de tuberculose aient historiquement été élevés, au cours des dernières années, il y a eu une augmentation rapide qui a été associée à une épidémie simultanée d’infection à VIH.

Figure Vue largeTélécharger l’incidence de la tuberculose active et de la séroprévalence de l’infection par le VIH déterminée par ELISA chez les patients des consultations prénatales dans la région du Cap-Occidental en Afrique du Sud pendant la période – Figure Agrandir la tuberculose active et la séroprévalence de l’infection par ELISA chez les participants des consultations prénatales dans la région du Western Cape en Afrique du Sud pendant la période – Nous avons observé une augmentation de la proportion de souches W-Beijing isolées d’enfants qui se sont présentés à un important hôpital régional pédiatrique pendant plusieurs années. Pour déterminer si cela reflétait une tendance à long terme, nous avons génotypé des souches de M tuberculosis isolées à partir d’échantillons histologiques archivés sur une période de plusieurs années. Nous avons découvert que les souches W-Beijing ont récemment émergé et deviennent rapidement plus fréquentes au Cap. que ces souches possèdent un avantage sélectif significatif

Matériaux et méthodes

Selection d’Echantillon

Isolats de culture de l’hôpital pour enfants de la Croix-Rouge Pendant la période -, nous avons réalisé des cultures de M tuberculose pour les enfants se présentant à notre hôpital Hôpital pour enfants de la Croix-Rouge; Les prélèvements pour culture ont été obtenus à partir de sites respiratoires, par exemple, lavage gastrique ou prélèvements d’expectorations induites ou, le cas échéant, d’autres sites pathologiques, p. Ex., LCR, aspiration articulaire ou prélèvement d’un ganglion lymphatique. les études à notre hôpital ont documenté la confirmation de la culture de M tuberculosis chez% des enfants étudiés pour tuberculose Les cas confirmés par culture représentent une minorité du nombre total de cas pédiatriques ~ les cas pédiatriques ont été enregistrés au Cap annuellement pendant – , parce que la collecte d’échantillons chez les enfants nécessite habituellement une hospitalisation. Par conséquent, bien que cet échantillon puisse représenter des cas de maladie plus grave, il a été limité par le besoin d’hospitalisation pour obtenir des spécimens de culture. période de l’année – des patients qui sont morts de tubercule actif Cette clinique regroupe les principaux hôpitaux de référence tertiaires qui desservent la grande région du Cap et reçoit des patients de la même région que l’hôpital de la Croix-Rouge. Tous les échantillons de tissus que nous avons utilisés ont été testés négatifs au VIH au moment de l’autopsie. un examen post-mortem complet n’a pas été effectué chez les patients infectés par le VIH Avant, le test VIH n’avait pas été effectué Des données démographiques étaient enregistrées pour chaque patient Des échantillons de tissus provenaient principalement des poumons et des sites extrapulmonaires étaient sélectionnés si le tissu pulmonaire affecté n’était pas disponible. les lames colorées à l’éosine ont été examinées pour confirmer la présence d’une infection à M tuberculosis Les échantillons pour lesquels les caractéristiques histologiques n’étaient pas favorables au diagnostic de tuberculose ont été exclus

Extraction d’ADN

L’extraction de l’ADN mycobactérien à partir d’échantillons de tissus inclus en paraffine a été réalisée en utilisant une méthode basée sur Chelex Bio-Rad

Spoligotypage

Le spoligotypage a été réalisé comme décrit ailleurs Les souches W-Pékin ont été identifiées par un motif facilement reconnaissable – étaient absentes, et des espaceurs – étaient présents Nous avons classé les résultats selon les critères suivants: les souches W-Pékin possibles étaient définies par l’absence d’espaceurs – et la présence d’au moins espaceur dans la région -; Les souches W-Beijing ont été définies par l’absence d’espaceurs – et la présence d’espaceurs -; Les souches euro-américaines étaient définies par l’absence d’espaceurs – et la présence d’espaceurs flanquants autour de cette région; d’autres souches non pékinoises ont été définies par la présence évidente d’espaceurs multiples entre, et non, W-Beijing, où la suppression des espaceurs – n’était pas clairement définie; Nous avons choisi la large désignation euro-américaine plutôt que d’attribuer à ces souches une classification spécifique selon la base de données des spoligotypes, car les modèles étaient souvent incomplets et ne permettaient pas de sous-classification spécifique.

Mesures de contrôle de la qualité

Pour éviter la contamination croisée, une section de tissu témoin négatif a été coupée entre les échantillons pour obtenir une surface «propre à la PCR». La lame de microtome a été remplacée et les gants ont été jetés après l’obtention de chaque échantillon. les procédures d’extraction et de post-PCR ont été menées dans des laboratoires distincts à des jours différents. Des échantillons de contrôle tissulaire positif et négatif ont été inclus lors de l’extraction de l’ADN et du génotypage.Une extraction réussie a été définie par un résultat interprétable en plus d’un spoligotypage réussi. pour un échantillon de contrôle par lots d’extraction, une suspension de Chelex sans échantillon de tissu et un échantillon de tissu témoin négatif. Pour obtenir un résultat interprétable, il était souvent nécessaire de répéter l’extraction d’ADN et le spoligotypage sur des échantillons de tissus prélevés indépendamment.

Analyse du polymorphisme nucléotidique unique

Pour confirmer l’analyse des spoligotypes, nous avons amplifié et séquencé un fragment d’une paire de bases de l’ADN de M tuberculosis pour détecter la présence d’un polymorphisme mononucléotidique discriminatoire à la position HRv dans tous les échantillons contenant des souches W-Beijing et dans une sélection aléatoire d’échantillons non W -Les souches de Beijing Les souches W-Beijing contiennent une adénine, et les souches non-W-Beijing contiennent une base guanine à cette position La paire d’amorces suivante a été utilisée: forward CCTTGGTCGGGCACATTC HRv -; reverse TAGCGCAGAATCTCTAGGACC – Le produit a été purifié et le séquençage du cycle a été effectué pour l’amorce inverse seulement

Analyses statistiques

L’analyse statistique a été réalisée en utilisant Prism Software, version Logiciel Graphpad, et Stata, version StataCorp Les données non appariées non paramétriques ont été analysées en utilisant le test U de Mann-Whitney. Le test de probabilité de Fisher a été utilisé pour les analyses de contingence. Le test de Kruskal-Wallis a été utilisé pour comparer les âges médians Nous avons utilisé la régression logistique pour contrôler les effets de l’âge et de l’origine ethnique sur l’association entre le temps mesuré comme une variable dichotomique, soit par décennie, soit par décennie. par période désignée et le nombre de souches W-Beijing identifiées La signification statistique a été déduite par P & lt; L’approbation de cette étude a été obtenue auprès du comité d’éthique de la recherche de l’Université du Cap.

Résultats

Souches pédiatriques récentes Pendant -, des isolats d’enfants ont été obtenus; % de ces isolats étaient W-Beijing La proportion des souches totales qui étaient des souches W-Beijing a augmenté de% en à% dans P =, pour – vs – figure A

Figure Vue largeDownload slideChangements dans la proportion des souches totales de Mycobacterium tuberculosis qui étaient des souches W-Beijing à Cape Town, Afrique du Sud A, La proportion de tous les isolats d’enfants atteints de tuberculose confirmée par culture à l’hôpital Red Cross Children’s Cape étaient des isolats de W-Pékin P =, par le test exact de Fisher pour – vs – B, la proportion du total de M échantillons tuberculeux positifs trouvés dans les échantillons de tissus postmortem avec des preuves histologiques de tuberculose de la période – qui étaient positifs pour la souche W-Beijing OU pour – vs -,; % CI, -Figure Vue largeDownload slideChangements dans la proportion des souches totales de Mycobacterium tuberculosis qui étaient des souches W-Beijing au Cap, Afrique du Sud A, La proportion de tous les isolats d’enfants atteints de tuberculose confirmée par la culture à l’hôpital Croix-Rouge la période – où W-Beijing isolait P =, par le test exact de Fisher pour – vs – B, la proportion du total des M échantillons tuberculeux positifs trouvés dans les échantillons de tissus post-mortem avec des preuves histologiques de tuberculose de la période – qui étaient positifs pour la Souche W-Beijing OU pour – vs -,; % CI, -La majorité des échantillons% étaient d’origine pulmonaire% étaient des échantillons de lavage gastrique, et% étaient des spécimens d’expectorations induites Les souches W-Pékin n’étaient pas plus susceptibles que les souches non-W-Pékin d’être isolées des échantillons extrapulmonaires que des spécimens pulmonaires rapport de risque, ; % IC, – Les caractéristiques cliniques et microbiologiques des cas pédiatriques sont détaillées dans le tableau L’infection par le VIH a été confirmée en% d’enfants; cependant, il n’y avait aucune différence entre les enfants infectés par W-Beijing et ceux infectés par des souches non-W-Beijing en ce qui concerne la proportion de cas de maladie disséminée chez les enfants par rapport aux enfants; rapport de risque, ; % CI, – ou la co-infection VIH des enfants vs des enfants; rapport de risque, ; % IC, – La majorité des enfants vivaient dans la grande région métropolitaine de Cape Town La proportion d’enfants de l’extérieur du Cap n’a pas changé au cours de la période d’étude.

DiapositivesTasses de tuberculose ayant causé une infection à l’Hôpital pour enfants de la Croix-Rouge à Cape Town, Afrique du Sud pendant la période -, par des caractéristiques cliniques associées , par des caractéristiques cliniques associées. Des souches dans des échantillons histologiques archivés Nous avons pu obtenir un modèle de spoligotype interprétable dans% des échantillons de tissus sélectionnés, et dans le reste des échantillons de tissus, l’ADN était dégradé. Tableau de Beijing Au cours des prochaines décennies,% de modèles ont été W-Pékin, et dans la dernière décennie -, les souches W-Pékin ont été identifiées en% d’échantillons de tissus OU pour – vs -,; % CI, – figure B Au cours de la dernière décennie -, toutes les souches W-Beijing ont été identifiées dans des échantillons de la période – de souches, et aucune n’a été identifiée dans les échantillons de la période – Par comparaison, il y avait une proportion de souches euro-américaines à diminuer au cours de la période d’étude OU pour – vs -,; % CI, –

Vue de la table largeLongues linéaires déterminées par spoligotypage d’échantillons histologiques archivés de patients décédés de tuberculose au cours de la période -Tableau de vueTéléchargementLonguesLignes de la traînée déterminées par spoligotypage d’échantillons histologiques archivés de patients morts de tuberculose pendant la période -Il n’y a pas eu de souches classifié comme possible W-Beijing ie, toutes les souches avec des espaceurs – absent avait des espaceurs – présent Cependant, pour confirmer la classification des spoligotypes, nous avons effectué une analyse de polymorphisme mononucléotidique. Nous avons obtenu une séquence interprétable des échantillons de échantillons de tissus non-W-Beijing testés Dans tous les cas, les données de séquence concordaient avec la classification attribuée par le spoligotype. Les caractéristiques démographiques des patients sont présentées dans le tableau Les années d’âge médianes; gamme, – années était plus faible au cours des premières décennies – que pendant les dernières décennies -; P & lt ;, par χ test de tendance, principalement en raison du grand nombre d’examens post-mortem effectués pour les enfants atteints de méningite tuberculeuse au cours des décennies précédentes L’émergence de souches W-Pékin est restée statistiquement significative lorsque tous les cas de méningite ont été exclus. ,; % CI, –

Tableau View largeTélécharger les caractéristiques démographiques des patients chez qui des échantillons post-mortem étaient disponibles pour le génotypage des souchesTable View largeTélécharger les caractéristiques démographiques des patients chez qui des échantillons post-mortem étaient disponibles pour le génotypage des souchesNous avons observé un changement dans l’origine ethnique des patients. les périodes plus récentes P & lt ;; par χ test de tendance Cependant les patients noirs africains n’étaient pas plus susceptibles que les patients de couleur Cape d’avoir été infectés par une souche W-Beijing. % CI, – En outre, après l’utilisation de la régression logistique pour contrôler les effets de l’âge et de l’origine ethnique, le temps est resté un prédicteur significatif de l’émergence des souches W-Pékin en comparant la période – avec la période; % CI, – ou exprimé comme une augmentation des cotes par décennie OU par décennie; % CI, – L’âge et l’origine ethnique n’étaient pas des prédicteurs du génotype W-Beijing

Discussion

génotype, mais cela peut refléter le petit nombre d’échantillons d’enfants au cours des dernières décennies, cela tendrait à sous-estimer l’ampleur de l’émergence des souches W-Beijing. Il y a eu un changement dans l’ethnicité des patients subissant des examens postmortem pendant la période étudiée. , probablement en raison de la migration urbaine des individus d’origine noire africaine vers Cape Town Ce changement a longtemps précédé l’émergence des souches W-Beijing et est peu susceptible de rendre compte de notre observation de l’émergence. lignée par analyse multivariée Les migrations internationales sont peu susceptibles de rendre compte de nos résultats, car il n’y a pas eu de migration significative documentée en Asie de l’Est, en Russie ou en Europe de l’Est où W-Beijing est présent dans la région du Cap ces dernières années. Région du Cap – il y a des années, la densité de population des peuples autochtones Khoi-San était faible, et historique ds suggèrent que la tuberculose était rare ou inconnue On pense que la colonisation européenne a introduit la maladie; En effet, pendant quelques années, le Cap a été promu en tant que centre de santé pour les consommateurs européens Cela coïncide avec notre constatation que la majorité des souches trouvées au début du siècle appartiennent à la lignée euro-américaine, prédominante en Europe Un mélange entre les populations est-asiatique, khoï-san, européenne et noire a donné naissance à la soi-disant population colorée du Cap . Les souches W-Pékin étant communes en Asie de l’Est, il était surprenant que les souches W-Beijing Peu fréquents ou absents durant les premières décennies de cette étude, lorsque la majorité des tissus provenaient de patients d’origine colorée du Cap. Les souches W-Pékin sont maintenant fréquentes chez les patients de couleur Cape atteints de tuberculose. Quelles sont les raisons potentielles de l’émergence de ces souches? Leur expansion rapide en proportion des souches totales suggère que d’autres facteurs que l’échec général de la lutte antituberculeuse peuvent être importants. L’association entre les souches de W-Beijing et les position a été signalée au Cap et ailleurs ; Cependant, la majorité des souches de W-Beijing au Cap restent sensibles aux médicaments % des souches étaient sensibles à l’isoniazide et à la rifampicine dans nos cas pédiatriques. Caws et al ont documenté une forte association entre la lignée W-Beijing et l’infection VIH au Vietnam Une épidémie d’infection due à la souche W-Beijing à New York s’est produite principalement chez les personnes infectées par le VIH,% Il est donc intéressant que l’émergence de la souche W-Beijing coïncide avec la propagation du VIH Cependant, comme les échantillons de tissus utilisés pour cette étude proviennent de personnes non infectées par le VIH, il n’est pas possible de déterminer si l’infection par le VIH a contribué à l’émergence de la maladie. , des changements rapides dans la répartition des souches peuvent être plus susceptibles de se produire dans une population avec une forte prévalence de l’infection par le VIH. La virulence accrue de certaines souches W-Beijing dans les expe Les modèles expérimentaux ont été associés à la subversion des réponses immunitaires innées par la production de glycolipides phénoliques ou par l ‘induction de lymphocytes T régulateurs produisant de l’ IL . Les souches W – Beijing ont également montré une régulation ascendante constitutive du DosR. dormance regulon , qui peut conférer un avantage de survie dans des conditions anaérobies Il est possible mais non prouvé que la subversion immunitaire peut entraîner une proportion élevée d’infections évoluant vers une maladie active. La subversion immunitaire peut également être liée à une charge bacillaire accrue, comme le démontrent certains animaux. modèles La co-infection au VIH, associée à une augmentation de la charge bacillaire , peut avoir un effet synergique Une augmentation de la charge bactérienne dans les poumons peut augmenter la transmissibilité et augmenter la probabilité de dissémination vers des sites extrapulmonaires. entre la souche W-Beijing et la tuberculose extrapulmonaire Certains auteurs ont suggéré que Bacille Calmette-Gu La vaccination systématique contre Bacille Calmette-Guérin en Afrique du Sud a commencé et est maintenant presque universelle , se rapprochant étroitement de la période pendant laquelle les souches de W-Beijing se sont développées. Cependant, nous n’avons pas de données qui relient spécifiquement les souches de W-Pékin avec la vaccination préalable par bacille de Calmette-Guérin. A notre connaissance, ces données sont les premières à documenter clairement l’émergence et la propagation rapide des souches de tuberculose de W-Pékin. Endémique sur une période prolongée Nos résultats suggèrent que ces souches possèdent un avantage significatif dans leur capacité à se disséminer dans une communauté. La base biologique de cet avantage doit être élucidée pour comprendre et intervenir dans la propagation de ces souches.

Remerciements

Nous remercions Morea Petersen et le personnel du Département de pathologie anatomique, Université du Cap, pour leur aide dans l’obtention et la coupe des coupes de tissus; Dr Tom Connell, pour sa lecture critique du manuscrit; et Dr Francesca Little, pour une aide à l’analyse statistique. Soutien financier Wellcome Trust Fellowships à MPN et à RJW, Fondation nationale de recherche sud-africaine Prix à MPN, et Royal Children’s Hospital Bourse d’études à DCPotentiel conflits d’intérêts Tous les auteurs: aucun conflit